View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7150_low_24 (Length: 222)
Name: NF7150_low_24
Description: NF7150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7150_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 32 - 209
Target Start/End: Complemental strand, 42326901 - 42326724
Alignment:
| Q |
32 |
ggaggaggaggaaggccgttcttgggttatgcgccaccgccattgttctagttcagtattgttctcttcttattttcgttgttcatgcatggaggagttt |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42326901 |
ggaggaggaggaaggccgttcttgggttatgcgccaccgccattgttctagttcagtattgttctcttcttattttcgttgttcatgcatggacgagttt |
42326802 |
T |
|
| Q |
132 |
gttttttgttttaataaattatgacttgttagaattggtatttgtaattactcgtttattgggattcatgttcatatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42326801 |
gttttttgttttaataaattatgacttgttagaattggtatttgtaattactcgtttattgggattcatgttcatatt |
42326724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 38 - 94
Target Start/End: Complemental strand, 42319514 - 42319458
Alignment:
| Q |
38 |
ggaggaaggccgttcttgggttatgcgccaccgccattgttctagttcagtattgtt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42319514 |
ggaggaaggccgttcttgggttatgcgccaccgccattgttctagttcagtattgtt |
42319458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University