View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7150_low_9 (Length: 407)
Name: NF7150_low_9
Description: NF7150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7150_low_9 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 407; Significance: 0; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 407; E-Value: 0
Query Start/End: Original strand, 1 - 407
Target Start/End: Complemental strand, 29606874 - 29606468
Alignment:
| Q |
1 |
tgtgtgtaggtgctggtgctggtgcttctttggccggtgctggtgcttttggaacctttgcaggtgctggggatacctttggtggtttagaagctggtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606874 |
tgtgtgtaggtgctggtgctggtgcttctttggccggtgctggtgcttttggaacctttgcaggtgctggggatacctttggtggtttagaagctggtgg |
29606775 |
T |
|
| Q |
101 |
taatggtaatggtggaagtgaaacaggtggtatagataatggtggtagagaaacaggtgcttttttgggtggatgtggtggtggttgaattttaggggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606774 |
taatggtaatggtggaagtgaaacaggtggtatagataatggtggtagagaaacaggtgcttttttgggtggatgtggtggtggttgaattttaggggat |
29606675 |
T |
|
| Q |
201 |
ggggtttttgggcttaatgccggtgtaacctttgggactggcaactttacaggagcgagttttggaggatccggaactggtgatttgacaggagcagttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606674 |
ggggtttttgggcttaatgccggtgtaacctttgggactggcaactttacaggagcgagttttggaggatccggaactggtgatttgacaggagcagttg |
29606575 |
T |
|
| Q |
301 |
ttggaggttttgattttggaactggtggtttcacaggagaaggttttggtgcgggagctttcggaactggtggtttcaaaggagcagatgttggagttgt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606574 |
ttggaggttttgattttggaactggtggtttcacaggagaaggttttggtgcgggagctttcggaactggtggtttcaaaggagcagatgttggagttgt |
29606475 |
T |
|
| Q |
401 |
agttttt |
407 |
Q |
| |
|
||||||| |
|
|
| T |
29606474 |
agttttt |
29606468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 363 - 407
Target Start/End: Complemental strand, 29606377 - 29606333
Alignment:
| Q |
363 |
ggaactggtggtttcaaaggagcagatgttggagttgtagttttt |
407 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| |||| |||| |
|
|
| T |
29606377 |
ggaactggcggtttcacaggagcagatgttggagtcgtagctttt |
29606333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University