View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7151_low_7 (Length: 334)
Name: NF7151_low_7
Description: NF7151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7151_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 11 - 315
Target Start/End: Complemental strand, 40892303 - 40891999
Alignment:
| Q |
11 |
gtgttatatactttgttattatcattaatccatcggtaaatatttctttattggcaaaggggattgtgagaagcttcttcatcaatggaatggaaaccct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40892303 |
gtgttatatactttgttattatcattaatcgataggtaaatatctctttattggcaaaggggattatgagaagcttcttcatcaatggaatggaaaccct |
40892204 |
T |
|
| Q |
111 |
atatgttttcaacgatgtttgtttctttgcaagttttaatatttatttttctgccacaatcttaaattggccaccatgttaacaaccgcttgtttcatgg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40892203 |
atatgttttcaacgatgtttgtttctttgcaagttttaatatttatttttctgccacaatcttaaattggccaccatgttaacaaccgcttgtttcatgg |
40892104 |
T |
|
| Q |
211 |
tatttcgtgttgcttaatgttgatttattttttagtttagttattggtactttgatatgcatttaggaatgctgtgcagttggctccatttatttgtttt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40892103 |
tatttcgtgttgcttaatgttgatttattttttagtttagttattggtactttgatatgcatttaggaatgctgtgcagttggctccatttatttgtttt |
40892004 |
T |
|
| Q |
311 |
ctttg |
315 |
Q |
| |
|
||||| |
|
|
| T |
40892003 |
ctttg |
40891999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University