View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7152_high_3 (Length: 234)
Name: NF7152_high_3
Description: NF7152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7152_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 17109950 - 17110178
Alignment:
| Q |
1 |
ttaactcttaaaaactgtcccaacataaaacgtctaccgaaggagggtctacctagatccatatcaactttacagattttggggaactgtccattccttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17109950 |
ttaactcttaaaaactgtcccaacataaaacgtttaccgaaggagggtctacctagatccatatcaactttacagatttcggggaactgtccattccttt |
17110049 |
T |
 |
| Q |
101 |
tagaaagatgcaagaaaccttatggaa-----------aggattgcgcatattcaatgtataatgattgacgatcctgagagggaccaacagtcatagtg |
189 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17110050 |
tagaaagatgcaagaaaccttatggaaaggattgcgagaggattgcgcatattcaatgtataatgattgacgatcctgagagggaccaacagtcatagtg |
17110149 |
T |
 |
| Q |
190 |
cccaacaattactcaggtacctactattt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17110150 |
cccaacaattactcaggtacctactattt |
17110178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University