View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7153_high_8 (Length: 302)
Name: NF7153_high_8
Description: NF7153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7153_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 56 - 295
Target Start/End: Original strand, 28423063 - 28423302
Alignment:
| Q |
56 |
acataattatattgaatcctgtcatctgtgtccggtgattaatctttttatttttgtagttttcaacacgaattcaaatcagagcgtgattctcacgtac |
155 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28423063 |
acataattatattgaatcatgtcatctgtgtccggtgattaatctttttatttttgtagttttcaacacgaattcaaatcagagcgtgattctcacgtac |
28423162 |
T |
 |
| Q |
156 |
aacaaaaccgcatacacgagctgcaccgccgacgactccgacgttggaacattcatctacaacggtggaaccaataatttcagcgaaacattgactattc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28423163 |
aacaaaaccgcatacacgagctgcaccgcagacgactccgacgttggaacattcatctacaacggtggaaccaataatttcagcgaaacgttgactattc |
28423262 |
T |
 |
| Q |
256 |
ccgttccgttgactattgtgggactcaactacttcttctc |
295 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28423263 |
ccgttccgttgactattgtgggacccaactacttcttctc |
28423302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University