View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7153_low_14 (Length: 238)
Name: NF7153_low_14
Description: NF7153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7153_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 2 - 190
Target Start/End: Original strand, 21770037 - 21770225
Alignment:
| Q |
2 |
aagtcgtatagtgtgggagagaaaagggctcttgaatgccttgggaaatttgtacgcatcttgtacttgggtttagttcttgctgtattggccggatctc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
21770037 |
aagtcgtatagtgtgggagagaaaagggctcttgaatgccttaggaaatttgtacgcatcttgtactcgggtttagttcttgctgtattagccggatctc |
21770136 |
T |
 |
| Q |
102 |
aaccatttctttgtgaataatataaatgaacctttaagtggatccccaacctagcatgattcaagcatggtgttgcatgtccctcttcc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21770137 |
aaccatttctttgtgaataatataaatgaacctttaagtggatccccaacctaacataattcaagcatggtgttgcatgtccctcttcc |
21770225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 43
Target Start/End: Complemental strand, 37937923 - 37937888
Alignment:
| Q |
8 |
tatagtgtgggagagaaaagggctcttgaatgcctt |
43 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37937923 |
tatagtgtgggagagaaaaggcctcttgaatgcctt |
37937888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University