View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7153_low_5 (Length: 401)
Name: NF7153_low_5
Description: NF7153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7153_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 4e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 20 - 194
Target Start/End: Original strand, 4717295 - 4717469
Alignment:
| Q |
20 |
ctgtctcccgacacctcatgaagcataaatctccattcatcaatctaatcttcatataatttcttccattttcttctttgttgttagattgttaatttag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4717295 |
ctgtctcccgacacctcatgaagcataaatctccattcatcaatctaaccttcatataatttcttccattttcttctttgttgttagattgttaatttag |
4717394 |
T |
 |
| Q |
120 |
gtttagtttgttcattgtgtggtgttagaacccacctaaaaaatcgatttcaatgttttgtaacttaaatatgaa |
194 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
4717395 |
gtttagtttgttgattgtgtgctgttagaacccacctaaaaaatagatttcaatgttttggaacttaaatatgaa |
4717469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University