View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7154_high_1 (Length: 380)
Name: NF7154_high_1
Description: NF7154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7154_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 19 - 361
Target Start/End: Complemental strand, 47359004 - 47358665
Alignment:
| Q |
19 |
cgtagtccataagcgtccaccctaaataattgaataaggtcccccacgggcattgacaattgggcacagacaattaagcatgaaccaaacttaaaatggt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47359004 |
cgtagtccataagcgtccaccctaaataatttaataaggtcccccacgggcattgacaattgggcacagacaattaagcatgaaccaaacttaaaatggt |
47358905 |
T |
 |
| Q |
119 |
gagtttgctttttagactggagaaataaaaacaattaagacgtacgtacagcgtgcacggcaggggaagaagtagacattgtttttaatgcatgcctttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47358904 |
gagtttgctttttagactggagaaataaaaacaattaagacgtacgtacagcgtgcacggcaggggaagaagtagacattgtttttaatgcatgcctttg |
47358805 |
T |
 |
| Q |
219 |
tgattgtggttgatgatgatacagcaccattacattattacatgatgagtaccctaaagttttgctattatagataaacataaacatgcatgcatgtggt |
318 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47358804 |
tgattgtggttgatgatgatgcagcactattac---attacatgatgagtaccctaaagttttgctattatagataaacataaacatgcatgcatgtggt |
47358708 |
T |
 |
| Q |
319 |
tcatcatcactgtccttttaggccatctctggtgggtctgcct |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47358707 |
tcatcatcactgtccttttaggccatctctggtgggtctgcct |
47358665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University