View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7154_high_2 (Length: 337)
Name: NF7154_high_2
Description: NF7154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7154_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 154 - 319
Target Start/End: Original strand, 23918166 - 23918331
Alignment:
| Q |
154 |
tgtgcatggaccttagccacgagtttttcggcctagacgctaataacacgaaagcactttggtcctgggttttcgatctctgtttttgcgcttagtcttg |
253 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
23918166 |
tgtgtatggaccttagccatgagtttttcggcctatacgctaataacacgaaaacactttggtcctaggttttcaatctctatttttgcgcttagtcttg |
23918265 |
T |
 |
| Q |
254 |
cttctttggtcacttcccttttcttgctaaagaaactttatcaccatctcctgggcgatccgttca |
319 |
Q |
| |
|
||| ||||||||| |||||||||||||||||||||||||||| |||| |||| || ||||| |||| |
|
|
| T |
23918266 |
cttatttggtcacatcccttttcttgctaaagaaactttatcgccatgtcctaggtgatccattca |
23918331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University