View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7154_high_2 (Length: 337)

Name: NF7154_high_2
Description: NF7154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7154_high_2
NF7154_high_2
[»] chr2 (1 HSPs)
chr2 (154-319)||(23918166-23918331)


Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 154 - 319
Target Start/End: Original strand, 23918166 - 23918331
Alignment:
154 tgtgcatggaccttagccacgagtttttcggcctagacgctaataacacgaaagcactttggtcctgggttttcgatctctgtttttgcgcttagtcttg 253  Q
    |||| |||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||| ||||||| |||||| ||||||||||||||||||    
23918166 tgtgtatggaccttagccatgagtttttcggcctatacgctaataacacgaaaacactttggtcctaggttttcaatctctatttttgcgcttagtcttg 23918265  T
254 cttctttggtcacttcccttttcttgctaaagaaactttatcaccatctcctgggcgatccgttca 319  Q
    ||| ||||||||| |||||||||||||||||||||||||||| |||| |||| || ||||| ||||    
23918266 cttatttggtcacatcccttttcttgctaaagaaactttatcgccatgtcctaggtgatccattca 23918331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University