View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7154_low_4 (Length: 275)
Name: NF7154_low_4
Description: NF7154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7154_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 28 - 259
Target Start/End: Complemental strand, 5053839 - 5053608
Alignment:
| Q |
28 |
caacagtattgccactgtaatataagggattttaaagtctccacaacagtattgcaaccgcaattttgacatcttattcctgcatttttctgcaatataa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5053839 |
caacagtattgccactgtaatataagggattttaaagtctccacaacagtattgcaaccgcaattttgacatcttattcccgcatttttctgcaatataa |
5053740 |
T |
|
| Q |
128 |
aggtttgcaacataactagaaccactatatataatctatagttggtagtattagttttgtcaccgtcaagggacaatagtagttgtatagttttcagaaa |
227 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5053739 |
aggtttgcaacgtaactagaaccactatatataatctatagttggtagtattagttttgccaccgtcgagggacaatagtagttgtatagttttcagaaa |
5053640 |
T |
|
| Q |
228 |
ttgattcaaattctgtgatgcaaacaagtgaa |
259 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
5053639 |
ttgattcaaattctgtgatgctaacaagtgaa |
5053608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 24 - 82
Target Start/End: Complemental strand, 5053886 - 5053828
Alignment:
| Q |
24 |
tccgcaacagtattgccactgtaatataagggattttaaagtctccacaacagtattgc |
82 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
5053886 |
tccgcaacagtattgccacggtaatataagggattttgaagcctccacaacagtattgc |
5053828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University