View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7154_low_5 (Length: 259)
Name: NF7154_low_5
Description: NF7154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7154_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 49083051 - 49082847
Alignment:
| Q |
1 |
atcctattacactgcttcagtgaaatttagatggcgtgcataggcaaaacttacatgaggctcactannnnnnncactgcattcaatatttttgtgtgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49083051 |
atcctattacactgcttcagtgaaatttagatggcgtgcataggcaaaacttacatgaggctcactatttttttcactgcattcaatatttttgtgtgtg |
49082952 |
T |
 |
| Q |
101 |
gaagccacggaaccactagaatgattgcttgcagcattgttttctgcagcaacatcaagtttattctgtggaaatgttatgttttgaggaggcatgataa |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
49082951 |
gaagccacagaaccactagaatgattgcttgcagcattgttttctgcagcaacatcaagtttattctgtggaaatgttatattttgaggaggcatggtaa |
49082852 |
T |
 |
| Q |
201 |
tctgt |
205 |
Q |
| |
|
||||| |
|
|
| T |
49082851 |
tctgt |
49082847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University