View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7154_low_7 (Length: 219)
Name: NF7154_low_7
Description: NF7154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7154_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 4 - 148
Target Start/End: Complemental strand, 6486822 - 6486678
Alignment:
| Q |
4 |
aataacattcctcgtccacagtttatgcaatccgaaccccgattttccacaacagaagcctatactgacgatgactatgccatgcgtagcagcagcgccg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486822 |
aataacattcctcgtccacagtttatgcaatccgaaccccgattttccacaacagaagcctatactgacgatgactatgccatgcgtagcagcagcgccg |
6486723 |
T |
 |
| Q |
104 |
cctcccccatgagcccttactactacgaccctggaaggtctctcc |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486722 |
cctcccccatgagcccttactactacgaccctggaaggtctctcc |
6486678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 210
Target Start/End: Complemental strand, 6486653 - 6486615
Alignment:
| Q |
172 |
acataagttagcgattatgtcaattttctttattcatgt |
210 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
6486653 |
acataagttagtgattatgtcaattttctttatttatgt |
6486615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University