View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7156_low_2 (Length: 263)
Name: NF7156_low_2
Description: NF7156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7156_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 10 - 248
Target Start/End: Original strand, 45327759 - 45327997
Alignment:
| Q |
10 |
gcagagatatctaaataaatcttttacattgcaattacaagaactatggatttgacctataattataaagagggtaatggactattaggttacctgataa |
109 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
45327759 |
gcagagatatctaaataaatcctttacattgcaattacaagaactatggatttgacctataattataaagagggtaaaggactattaggttacctaataa |
45327858 |
T |
|
| Q |
110 |
aaccagtattgttgatatcagcagcaagccaatcttcaatagtaatttctctatgcaaaaccttcttagccaatctcctatgtcttctatcaattctagc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45327859 |
aaccagtattgttgatatcagcagcaagccaatcttcaatagtaatttctctatgcaaaaccttcttagccaatctcctatgtcttctatcaattctagc |
45327958 |
T |
|
| Q |
210 |
ttcagctaaataaagaaaagcccttgcaaccatcaaagt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45327959 |
ttcagctaaataaagaaaagcccttgcaaccatcaaagt |
45327997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University