View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7157_high_3 (Length: 331)
Name: NF7157_high_3
Description: NF7157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7157_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 87 - 316
Target Start/End: Complemental strand, 3504227 - 3503998
Alignment:
| Q |
87 |
ggttgataaataaaaccaagatatccaactagggcatttcactgtcaaacagaagcttctatcctcggctcgaaagaaaatgccgacataaactccatga |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3504227 |
ggttgataaataaaaccaagatatccaactagggcatttcactctcaaacagaagcttctatcctcggctcgaaagaaaatgccgacataaactccatga |
3504128 |
T |
 |
| Q |
187 |
cttctccattaatgcgacattttggcaattcaacccagtagttggttaccaaatcacacagaacataagtacatagctcaggagagttcaagcaaataaa |
286 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3504127 |
cttctccattaatgtgacattttggcaattcaacccagttgttggttaccaaatcacacagaacataagtacatagctcaggagagttcaagcatataaa |
3504028 |
T |
 |
| Q |
287 |
aatccgagaaccggcaccaacacaattgat |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3504027 |
aatccgagaaccggcaccaacacaattgat |
3503998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University