View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7157_low_3 (Length: 331)

Name: NF7157_low_3
Description: NF7157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7157_low_3
NF7157_low_3
[»] chr1 (1 HSPs)
chr1 (87-316)||(3503998-3504227)


Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 87 - 316
Target Start/End: Complemental strand, 3504227 - 3503998
Alignment:
87 ggttgataaataaaaccaagatatccaactagggcatttcactgtcaaacagaagcttctatcctcggctcgaaagaaaatgccgacataaactccatga 186  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3504227 ggttgataaataaaaccaagatatccaactagggcatttcactctcaaacagaagcttctatcctcggctcgaaagaaaatgccgacataaactccatga 3504128  T
187 cttctccattaatgcgacattttggcaattcaacccagtagttggttaccaaatcacacagaacataagtacatagctcaggagagttcaagcaaataaa 286  Q
    |||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
3504127 cttctccattaatgtgacattttggcaattcaacccagttgttggttaccaaatcacacagaacataagtacatagctcaggagagttcaagcatataaa 3504028  T
287 aatccgagaaccggcaccaacacaattgat 316  Q
    ||||||||||||||||||||||||||||||    
3504027 aatccgagaaccggcaccaacacaattgat 3503998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University