View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7157_low_5 (Length: 251)
Name: NF7157_low_5
Description: NF7157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7157_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 236
Target Start/End: Complemental strand, 40892303 - 40892078
Alignment:
| Q |
11 |
gtgttatatactttgttattatcattaatccatcggtaaatatttctttattggcaaaggggattgtgagaagcttcttcatcaatggaatggaaaccct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40892303 |
gtgttatatactttgttattatcattaatcgataggtaaatatctctttattggcaaaggggattatgagaagcttcttcatcaatggaatggaaaccct |
40892204 |
T |
 |
| Q |
111 |
atatgttttcaacgatgtttgtttctttgcaagttttaatatttatttttctgccacaatcttaaattggccaccatgttaacaaccgcttgtttcatgg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40892203 |
atatgttttcaacgatgtttgtttctttgcaagttttaatatttatttttctgccacaatcttaaattggccaccatgttaacaaccgcttgtttcatgg |
40892104 |
T |
 |
| Q |
211 |
tatttcgtgttgcttaatgttgattt |
236 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40892103 |
tatttcgtgttgcttaatgttgattt |
40892078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University