View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7158_high_6 (Length: 342)
Name: NF7158_high_6
Description: NF7158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7158_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 15 - 256
Target Start/End: Complemental strand, 25783824 - 25783584
Alignment:
| Q |
15 |
ttatgcgtactgtgcttctgatgatgattattatgaagaccttctaccggaaaattggaaaggatctgtttatggggaccgtaatttgtccatgatgtta |
114 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25783824 |
ttatgcgttctgtgcttctgatgatgattattatgaagaccttctaccggaaaattggaatggatctgtttatggggaccataatttgtccatgatgtta |
25783725 |
T |
|
| Q |
115 |
aaacatgactgaaaattccgacggtgatccttgaaaattatgatgtgttctttcttttttcaatgttacttgtattccccctcccctaaaatggtttact |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
25783724 |
aaacatgactgaaaattccgacggtgatccttgaaaattatgatgtgttctttcttttttcaatgttacttgtattccccctcccct-aaatgttttact |
25783626 |
T |
|
| Q |
215 |
cttatgttgttggcatatgatttattaatgtaatagattatc |
256 |
Q |
| |
|
| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25783625 |
catatgttgttggcatatgctttattaatgtaatagattatc |
25783584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 277 - 324
Target Start/End: Complemental strand, 25783597 - 25783550
Alignment:
| Q |
277 |
tgtaatagattatttttgtttgaaagcttaactcttaactgcactttc |
324 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25783597 |
tgtaatagattatctttgtttgaaagcttaactcttaactgcactttc |
25783550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University