View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7158_low_10 (Length: 273)
Name: NF7158_low_10
Description: NF7158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7158_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 258
Target Start/End: Original strand, 48449091 - 48449335
Alignment:
| Q |
14 |
agaatgtgacatgattttcctcctctttgatagatcgataatttcaccatgtatacactaggtacactatttacctcttatagaattcaacaagctttgc |
113 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48449091 |
agaatgtgacatgtttttcctcctctttgatagatcgatcatttcaccatgtatacactaggtacactatttacctcttatagaattcaacaagctttgc |
48449190 |
T |
 |
| Q |
114 |
annnnnnncctaactaagaactcaatgtccaagttaacgtcttaacctttggaggtacacacacaaaacaaagatgtttttgttttatatagtataggag |
213 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48449191 |
atttttttcctaactaagaactcaatgtccaagttaacgtcttaacctttggaggcacacacacaaaacaaagatgtttttgttttatatagtataggag |
48449290 |
T |
 |
| Q |
214 |
ttgcgttcattgatgggtaaattggtttaactatgacatgttttt |
258 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48449291 |
ttgcgttcattgatgggtaaattagtttaactatgacatgttttt |
48449335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University