View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7158_low_6 (Length: 364)
Name: NF7158_low_6
Description: NF7158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7158_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 1 - 350
Target Start/End: Original strand, 28022633 - 28022982
Alignment:
| Q |
1 |
gaaatatcggtatcagaacttgtttttgatcttaaaagcaaaatcgaagacgagttggaggtgggagtacacaggcaaaatctctggtacaagggtgtag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28022633 |
gaaatatcggtatcagaacttgtttttgatcttaaaagcaaaatcgaaaacgagttggaggtgggagtacacaggcaaaatctctggtacaagggtatag |
28022732 |
T |
 |
| Q |
101 |
agttggataatgagaaaaggattggattctatgctttgtgcggagatgaaacagaaacagttactctcattgttgatccaccgccatcagacctgaaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
28022733 |
agttggataatgagaaaaggattggattctatgctttgcgcggagatgaaacagaaacagttactctcattgttgatccgctgccatcagacctgaaact |
28022832 |
T |
 |
| Q |
201 |
acatgttttagtgaagtttcttggccatggcagcaatggctatgtgagggtgaaggagaccgataaggtgagtgacctgtgcgacaaagtttcacgatat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
28022833 |
acatgttttagtgaagtttcttggccatggcagcaatggctatgtgagggtgaaggagaccgataaggtgagtgacctgtgcaacaaagtttcacggtat |
28022932 |
T |
 |
| Q |
301 |
tggggcattccccttgatactttcacccttcatcgtctcaatgttgaaat |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022933 |
tggggcattccccttgatactttcacccttcatcgtctcaatgttgaaat |
28022982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University