View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7159_high_10 (Length: 224)
Name: NF7159_high_10
Description: NF7159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7159_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 26473203 - 26473408
Alignment:
| Q |
1 |
gtcctaatctttcaattttggcctatgtatgtagcaccggaacttcagattgaatgcgtttttagtgtctgacatcgacacgattctgacacgtagttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26473203 |
gtcctaatctttcaattttggcctatgtatgtagcaccggaacttcagattgaatgtggttttagtgtctgacatcgacacgattctgacacgtggttaa |
26473302 |
T |
 |
| Q |
101 |
ctcagacacttttattttcttaaactattacaagtgtctatgtgtgagtatcatgtctggcgtctgtctcaattattcgtttattttgactagatgcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
26473303 |
ttcagacacttttattttcttaaactattacaagtgtctatgtgtgagtatcatgtctggcgtctgtctcaattatttgtatattttgactagatgcaaa |
26473402 |
T |
 |
| Q |
201 |
ctcaca |
206 |
Q |
| |
|
|||||| |
|
|
| T |
26473403 |
ctcaca |
26473408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 107 - 150
Target Start/End: Complemental strand, 32754643 - 32754600
Alignment:
| Q |
107 |
cacttttattttcttaaactattacaagtgtctatgtgtgagta |
150 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
32754643 |
cactttcattttcttaaactattacaagtgtctacgtgtcagta |
32754600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University