View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7159_low_8 (Length: 347)
Name: NF7159_low_8
Description: NF7159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7159_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 18 - 335
Target Start/End: Complemental strand, 36630927 - 36630610
Alignment:
| Q |
18 |
tatattatattgcaaatagctgctcattgaactcgaatttgacatcacattagaagtaaatccaggtacctgtttctcctagtagatttgtaatctcttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36630927 |
tatattatattgcaaatagctgctcattgaactcgaatttgacatcacattagaagtaaatccaggtacctgtttctcctagtagatttgtaatctcttg |
36630828 |
T |
 |
| Q |
118 |
tgccaaaagttaactttacgacagattctcttgagagggataatagtaaagatgaattaggcgtaattcctcacttgcaccttcgatgtacaaaggacgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
36630827 |
tgccaaaagttaactttacgacagattctcttgagagggataatagtaaagatgaattaggcgtaattcctcacttccaccttcgatgtacaaaagacgg |
36630728 |
T |
 |
| Q |
218 |
gttaggccaagttaagtgtgtctctcacccgatcttagcatttcgtcgggccaaatatttagatccaaactcaactttatctcaataaattactggttca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
36630727 |
gttaggccaagttaagtgtgtctctcacccgatcttagcattacgccgggccaaatatttagatccaaactcaactttatcttaataaattacgggttca |
36630628 |
T |
 |
| Q |
318 |
ataaggacaaaccacaca |
335 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
36630627 |
ataaggacaaatcacaca |
36630610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University