View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7160_low_5 (Length: 242)
Name: NF7160_low_5
Description: NF7160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7160_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 156 - 234
Target Start/End: Complemental strand, 4048477 - 4048399
Alignment:
| Q |
156 |
ttacctgaaatcagacgcaagccaattagaagaaagaaaatattattactttctttgttttcttcactagttatctttg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4048477 |
ttacctgaaatcagacgcaagccaattagaagaaagaaaatattattactttctttgttttcttcactagttatctttg |
4048399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 72 - 153
Target Start/End: Complemental strand, 4048731 - 4048649
Alignment:
| Q |
72 |
taataataatatataggagaaggggaaattatgtccaatcttagtttg-ttttaatcaaatgatgaatgagaacaacaaacat |
153 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4048731 |
taataataatatgcaggagaaggggaaattatgtccaatcttagtttgtttttaatcaaatgatgaatgagaacaacaaacat |
4048649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University