View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7160_low_5 (Length: 242)

Name: NF7160_low_5
Description: NF7160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7160_low_5
NF7160_low_5
[»] chr6 (2 HSPs)
chr6 (156-234)||(4048399-4048477)
chr6 (72-153)||(4048649-4048731)


Alignment Details
Target: chr6 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 156 - 234
Target Start/End: Complemental strand, 4048477 - 4048399
Alignment:
156 ttacctgaaatcagacgcaagccaattagaagaaagaaaatattattactttctttgttttcttcactagttatctttg 234  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4048477 ttacctgaaatcagacgcaagccaattagaagaaagaaaatattattactttctttgttttcttcactagttatctttg 4048399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 72 - 153
Target Start/End: Complemental strand, 4048731 - 4048649
Alignment:
72 taataataatatataggagaaggggaaattatgtccaatcttagtttg-ttttaatcaaatgatgaatgagaacaacaaacat 153  Q
    ||||||||||||  |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
4048731 taataataatatgcaggagaaggggaaattatgtccaatcttagtttgtttttaatcaaatgatgaatgagaacaacaaacat 4048649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University