View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7162_high_7 (Length: 221)
Name: NF7162_high_7
Description: NF7162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7162_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 18 - 146
Target Start/End: Complemental strand, 45214080 - 45213955
Alignment:
| Q |
18 |
gtcctctaactcacctttgcacaacacgcttgttcatgaacattttacaaacgccaaataatttatttattttttactttaagcaaaacgttttccttcc |
117 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||| |
|
|
| T |
45214080 |
gtcctctaactcaccttcgcacaacac--ttgttcatgaacattttacaaacgccaaataatttatat-ttttttactttaggcaaaacgttttccttcc |
45213984 |
T |
 |
| Q |
118 |
acattccttgccacaaacctcagccggtg |
146 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
45213983 |
acattccttgccacaaacctcagctggtg |
45213955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 45213966 - 45213911
Alignment:
| Q |
163 |
cctcagctggtgcaagtgggataacacttgtgtgatatagagttgggggacattga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
45213966 |
cctcagctggtgcaagtgggataacacttgtgtgacatagagttgggtgacattga |
45213911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 220
Target Start/End: Original strand, 47677249 - 47677293
Alignment:
| Q |
176 |
aagtgggataacacttgtgtgatatagagttgggggacattgacc |
220 |
Q |
| |
|
|||||||||||||||||||||| |||||||| || |||||||||| |
|
|
| T |
47677249 |
aagtgggataacacttgtgtgacatagagtttggtgacattgacc |
47677293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 218
Target Start/End: Original strand, 33689165 - 33689203
Alignment:
| Q |
180 |
gggataacacttgtgtgatatagagttgggggacattga |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
33689165 |
gggataacacttgtgtgacatagagttgggtgacattga |
33689203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 25617971 - 25618008
Alignment:
| Q |
181 |
ggataacacttgtgtgatatagagttgggggacattga |
218 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
25617971 |
ggataacacttgtgtgacatagagttgggtgacattga |
25618008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University