View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7162_low_6 (Length: 250)

Name: NF7162_low_6
Description: NF7162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7162_low_6
NF7162_low_6
[»] chr8 (1 HSPs)
chr8 (7-238)||(8866380-8866611)


Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 7 - 238
Target Start/End: Complemental strand, 8866611 - 8866380
Alignment:
7 tatactatatggtttgcataagaataagaatgctcaaattcatttgtcgggcaacacaaactagggtttaaattggacaacaatcagaagcaaaaggcga 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8866611 tatactatatggtttgcataagaataagaatgctcaaattcatttgtcgggcaacacaaactagggtttaaattggacaacaatcagaagcaaaaggcga 8866512  T
107 agagatttgcttttgcatgcgatgggggaccgcactatactatactatactaacattttatatcataacgagaatcttaacattattgaactatgccatg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
8866511 agagatttgcttttgcatgcgatgggggaccgcactatactatactatacttacattttatatcataacgagaatcttaacattattgaactatgccatg 8866412  T
207 ccacacttggcttcttggtttggccacaggtt 238  Q
    ||||||||||||||||||||||||||| ||||    
8866411 ccacacttggcttcttggtttggccacgggtt 8866380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University