View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7162_low_6 (Length: 250)
Name: NF7162_low_6
Description: NF7162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7162_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 7 - 238
Target Start/End: Complemental strand, 8866611 - 8866380
Alignment:
| Q |
7 |
tatactatatggtttgcataagaataagaatgctcaaattcatttgtcgggcaacacaaactagggtttaaattggacaacaatcagaagcaaaaggcga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8866611 |
tatactatatggtttgcataagaataagaatgctcaaattcatttgtcgggcaacacaaactagggtttaaattggacaacaatcagaagcaaaaggcga |
8866512 |
T |
 |
| Q |
107 |
agagatttgcttttgcatgcgatgggggaccgcactatactatactatactaacattttatatcataacgagaatcttaacattattgaactatgccatg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8866511 |
agagatttgcttttgcatgcgatgggggaccgcactatactatactatacttacattttatatcataacgagaatcttaacattattgaactatgccatg |
8866412 |
T |
 |
| Q |
207 |
ccacacttggcttcttggtttggccacaggtt |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
8866411 |
ccacacttggcttcttggtttggccacgggtt |
8866380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University