View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7163_high_10 (Length: 283)
Name: NF7163_high_10
Description: NF7163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7163_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 266
Target Start/End: Original strand, 46337262 - 46337511
Alignment:
| Q |
19 |
gccctaataccagtgttggaggtttctgtttatcttttactttttaaacagttttaaaaatcaagggctgatcggaattttccgcagctattcactgaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
46337262 |
gccctaataccagtgttggaggtttctgtttatcttttactttttaaacatttttaaaaatcaagggctcataggaattttccgcagctattcactgaaa |
46337361 |
T |
|
| Q |
119 |
agtgaaaactgtagttattatgaaagctgtagtgcatagaaggcatggatgattgaacnnnnnnncaacgtgctcgttcctc--tgatgtcatatagtgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| || |||||||||||| |
|
|
| T |
46337362 |
agtgaaaactgtagttattatgaaagctgtagtgcatagaaggcatggatgattgaacaaaaaaacaatgtgctcgttcctctatgcggtcatatagtgt |
46337461 |
T |
|
| Q |
217 |
ttggtttgtttatgatcatattcttgttgtgttgtcaattatattctttt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46337462 |
ttggtttgtttatgatcatattcttgttgtgttgtcaattatattctttt |
46337511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University