View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7163_high_14 (Length: 239)
Name: NF7163_high_14
Description: NF7163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7163_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 17735435 - 17735659
Alignment:
| Q |
1 |
gtggactagattgtttgtggggacaaagtgtattcccatcagaaaaaatgctcaaatctctgatgctccnnnnnnn-gattgatatttctaattctcatt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17735435 |
gtggactagattgtttgtggggacaaagtgtattcccatcagaaaaaatgctcaaatctctgatgctccttttttttgattgatatttctaattctcatt |
17735534 |
T |
 |
| Q |
100 |
tctcaaataattgagctatatactcattatttaggacccaagtcccaaattgtaggttcgtcctagatcatcaaaagctcagaaacgatcttggagacac |
199 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |||||||||||| |
|
|
| T |
17735535 |
tctcaaataattgagctgtatactcattatttaggacccaagtcccaaattgtaggttcgtcctagaccatcaaaagttcagaaacggtcttggagacac |
17735634 |
T |
 |
| Q |
200 |
aagtcacgtaacttgtctgcataat |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
17735635 |
aagtcacgtaacttgtctgcataat |
17735659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 145 - 192
Target Start/End: Original strand, 8733946 - 8733993
Alignment:
| Q |
145 |
caaattgtaggttcgtcctagatcatcaaaagctcagaaacgatcttg |
192 |
Q |
| |
|
||||||||| ||||||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
8733946 |
caaattgtaagttcgtcatagatcatcaaaatctcagaaacggtcttg |
8733993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 186
Target Start/End: Original strand, 19936311 - 19936354
Alignment:
| Q |
143 |
cccaaattgtaggttcgtcctagatcatcaaaagctcagaaacg |
186 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| |||||||||| |
|
|
| T |
19936311 |
cccaaattgtaggttcgtcctagaccaccaaaatctcagaaacg |
19936354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University