View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7163_high_7 (Length: 350)
Name: NF7163_high_7
Description: NF7163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7163_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 66 - 338
Target Start/End: Complemental strand, 8402993 - 8402721
Alignment:
| Q |
66 |
agttgctttcccatttaacatatgtttccaaacctatatatacatgcatgaatttacattttgagtttttagtatgaatgattcattggtactatttcac |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8402993 |
agttgctttcccatttaacatatgtttccaaacctatatatacatgcatgaatttacattttgagtttttagtatgaatgattcattggtactatttcac |
8402894 |
T |
 |
| Q |
166 |
annnnnnnatgcttttcttcttagttggggctaggggtgagaataaaatgtaatttgtataacattgtaagttttgcagctttatgctccggaaagaatt |
265 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8402893 |
atttttttatgcttttcttcttagttggggctaggggtgagaataaaatgtaatttgtataacattgtaagttttgcagctttatgctccagaaagaatt |
8402794 |
T |
 |
| Q |
266 |
gattctattactcttcccttggaccttggtatttgttggtcatgaacgcttcgcatatatctctatgtatttt |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8402793 |
gattctattactcttcccttggaccttggtatttgttggtcatgaacgcttcgcatatatctctatgtatttt |
8402721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University