View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7163_low_17 (Length: 234)
Name: NF7163_low_17
Description: NF7163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7163_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 11 - 215
Target Start/End: Original strand, 2496753 - 2496957
Alignment:
| Q |
11 |
gagtgagaagaagaagatatatgatgcaccaatatatctggcttacttgaacaatctatgtagaaatttgtggcgtgaatcaataattaaaacaaactga |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2496753 |
gagtcagaagaagaagatatatgatgcaccaatatatctggcttacttgaacaatctatgtagaaatttgtggcgtgaatcaataattaaaacaaactga |
2496852 |
T |
 |
| Q |
111 |
aaacaacacgggttatctgcagattaaatatatagatcaaatcannnnnnnatatttcaaataaaatcttacgcatacgtcatctcagcgtgggaaaata |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2496853 |
aaacaacacgggttatctgcagattaaatatatagatcaaatcatttttttatatttcaaataaaatcttacgcatacgtcatctcagcgtgggaaaata |
2496952 |
T |
 |
| Q |
211 |
aatta |
215 |
Q |
| |
|
||||| |
|
|
| T |
2496953 |
aatta |
2496957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University