View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7165_high_8 (Length: 399)
Name: NF7165_high_8
Description: NF7165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7165_high_8 |
 |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 18 - 388
Target Start/End: Original strand, 31086 - 31454
Alignment:
| Q |
18 |
tgcacatgttcttgccccattgtgggcttgtcatttctagttctttactttgatatattattggtggaggctcctcatgcatgcttaagaatgtattact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31086 |
tgcacatgttcttgccccattgtgggcttgtcatttctagttctttactttgatatattattggtggaggctcctcatgcatgcttaagaatgtattact |
31185 |
T |
 |
| Q |
118 |
tggcataattgaagaatccacaccctttcaatatcaaacatgtctactatggtgggcctttttatagttatagttatcgtccctgggtatatatgtgtac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31186 |
tggcataattgaagaatccacaccctttcaatatcaaacatgtctactatggtgggcctttttatagttatagttatcgtccctgggtatatatgtgtac |
31285 |
T |
 |
| Q |
218 |
aaaaactaaaatcatataaatttacacttataataacaacgatatttataacaatctcatattatagtacgaagagaagtgttagaaacactttttattc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31286 |
aaaaactaaaatcatataaatttacacttataataacaacaatatttataacaatctcatatgatagtacgaagagaagtgttagaaaca--ttttattc |
31383 |
T |
 |
| Q |
318 |
aacattttttataagactcggtattctattaggtgaaatttgtgtggattccaccactctatgatcttcat |
388 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31384 |
aacattttctataagactcggtattttattaggtgaaatttgtgtggattccaccactctatgatcttcat |
31454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University