View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7165_low_18 (Length: 239)
Name: NF7165_low_18
Description: NF7165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7165_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 45104004 - 45103781
Alignment:
| Q |
1 |
agctggtattatggtagatttatcaaaagagagaatgaatgtccttggagtgaacggtgatgatgaaggatgaagctttttccccgagctatctgaaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
45104004 |
agctggtattatggtagatttatcaaaagagagaatgaatgtccttggagtggatggtgttgataaaagatgaagttttttccccgagctatctgaaccg |
45103905 |
T |
 |
| Q |
101 |
tccatctcactagaagatgataaactgcttccagaatatgcaacaggttgctgaagaattatgtctctcaagaactcttcttcatcatcagtacttgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103904 |
tccatctcactagaagatgataaactgcttccagaatatgtaacaggttgctgaagaattatgtctctcaagaactcttcttcatcatcagtacttgttt |
45103805 |
T |
 |
| Q |
201 |
gatgacaatattgcccttgcatat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45103804 |
gatgacaatattgcccttgcatat |
45103781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 45130630 - 45130417
Alignment:
| Q |
1 |
agctggtattatggtagatttatcaaaagagagaatgaatgtccttggagtgaacggtgatgatgaaggatgaagctttttccccgagctatctgaaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| || |
|
|
| T |
45130630 |
agctggtattatggtagatttatcaaaagagagaatgaatgtccttggagtgaacggtgatgatgaaggatgaagctttttctttgagcaatctgagcca |
45130531 |
T |
 |
| Q |
101 |
tccatctcactagaagatgataaactgcttccagaatatgcaacaggttgctgaagaattatgtctctcaagaactcttcttcatcatcagtacttgttt |
200 |
Q |
| |
|
||||||||| |||| ||||||| | ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
45130530 |
tccatctcattagaggatgata---tacttccagaatatgtaacaggttgctgaaggattatgtctctcaagaactcttcttcatcatcagcactagttt |
45130434 |
T |
 |
| Q |
201 |
gatgacaatattgccct |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45130433 |
gatgacaatattgccct |
45130417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University