View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7166_low_6 (Length: 219)
Name: NF7166_low_6
Description: NF7166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7166_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 19684778 - 19684658
Alignment:
| Q |
1 |
agcataaaaaggagtgttcacttcacacttcactcttcaccgttcatccttcaaccttttctccactaaaccaaatccttgttcttcaagcaacaaatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19684778 |
agcataaaaaggagtgttcacttcacacttcactcttcaccgttcatccttcaaccttttctccactaaaccaaatccttgttcttcaagcaacaaatgg |
19684679 |
T |
 |
| Q |
101 |
aacttcccatcttacttcctt |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
19684678 |
aacttcccatcttacttcctt |
19684658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University