View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7167_high_11 (Length: 228)
Name: NF7167_high_11
Description: NF7167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7167_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 101 - 210
Target Start/End: Complemental strand, 55293927 - 55293818
Alignment:
| Q |
101 |
ctatctatgcttctttggtttgttgttagttagattcagaagacagaacccacaacacaaccaagtctacgacaactaaacaatgtttcacttttctagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55293927 |
ctatctatgcttctttggtttgttgttagttagattcagaagacagaacccacaacacaaccaagtctacgacaactaaacaatgtttcacttttctagt |
55293828 |
T |
 |
| Q |
201 |
cctccttcgt |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
55293827 |
cctccttcgt |
55293818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 55294019 - 55293950
Alignment:
| Q |
1 |
tgtaatatgatttcatattttgcttatagtactaaactgaaactatgttccgtttttgtaacttgtacta |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55294019 |
tgtaatatgatttcatattttgcttatagtactaaactgaaactatgttccgtttttgtaacttgtacta |
55293950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University