View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7167_high_9 (Length: 238)
Name: NF7167_high_9
Description: NF7167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7167_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 232
Target Start/End: Complemental strand, 2500332 - 2500116
Alignment:
| Q |
14 |
caaaaacccactactaaggttgattgcttgtcttttgattgagtataactacttatgtcttccatatccatatttttagagagtgaaatagaatg-ttga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
2500332 |
caaaaacccactactaaggttgattgcttgccttttgattgagtataactacttatgtcttccatatccatatttttagagagtg-aatagaatgtttga |
2500234 |
T |
 |
| Q |
113 |
gaggtgaataaccaacatgagaataaaatatacatagtaaatatgaggatgttgcactgaatgtgtgtggcaagacaaaatatgatatgattaaagatga |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||| | |||||||||| ||||||||||||||| |||||||| |
|
|
| T |
2500233 |
gaggtgaataatcaacatgagaataaaataaacatactaaatatgaggatgttgcactgaa--tctgtggcaagataaaatatgatatgatcaaagatga |
2500136 |
T |
 |
| Q |
213 |
aaatattagggagattatgg |
232 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2500135 |
aaatattagggagattatgg |
2500116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University