View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7167_high_9 (Length: 238)

Name: NF7167_high_9
Description: NF7167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7167_high_9
NF7167_high_9
[»] chr1 (1 HSPs)
chr1 (14-232)||(2500116-2500332)


Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 232
Target Start/End: Complemental strand, 2500332 - 2500116
Alignment:
14 caaaaacccactactaaggttgattgcttgtcttttgattgagtataactacttatgtcttccatatccatatttttagagagtgaaatagaatg-ttga 112  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||    
2500332 caaaaacccactactaaggttgattgcttgccttttgattgagtataactacttatgtcttccatatccatatttttagagagtg-aatagaatgtttga 2500234  T
113 gaggtgaataaccaacatgagaataaaatatacatagtaaatatgaggatgttgcactgaatgtgtgtggcaagacaaaatatgatatgattaaagatga 212  Q
    ||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||  | |||||||||| ||||||||||||||| ||||||||    
2500233 gaggtgaataatcaacatgagaataaaataaacatactaaatatgaggatgttgcactgaa--tctgtggcaagataaaatatgatatgatcaaagatga 2500136  T
213 aaatattagggagattatgg 232  Q
    ||||||||||||||||||||    
2500135 aaatattagggagattatgg 2500116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University