View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7167_low_10 (Length: 283)
Name: NF7167_low_10
Description: NF7167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7167_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 12 - 268
Target Start/End: Original strand, 35517328 - 35517584
Alignment:
| Q |
12 |
aacctgtgtgaatgattagatacagaagccaagtgtctcaaagtatcaaacaattctctagcagcagaaagtgttcttcgaacggtgcaaagctctggaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35517328 |
aacctgtgtgaatgattagatacagaagccaagtgtctcaaagtatcaaacaattctctagcagaagaaagtgttcttcgaacggtgcaaagctctggaa |
35517427 |
T |
 |
| Q |
112 |
cggtcaacaatttaccagaaacggcaacggagagaatgccagtcaagtcatgtattccagaaaagtcgagttgttgttgagggacgagtctggcagcgga |
211 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35517428 |
cggtcaacaatttaccagaaacggaaacggagagaatgtcagtcaagtcatgtattccagaaaagtcgagttgttgttgagggacgagtctggcagcgga |
35517527 |
T |
 |
| Q |
212 |
ggtttgatcgagaagcttttggctgtggtgtggagtaagtccgacgggtaaacgggc |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35517528 |
ggtttgatcgagaagcttttggctgtggtgtggagtaagtccgacgggtaaacgggc |
35517584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University