View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7167_low_13 (Length: 256)
Name: NF7167_low_13
Description: NF7167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7167_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 3 - 163
Target Start/End: Original strand, 29013973 - 29014131
Alignment:
| Q |
3 |
aacataaaacaaaaacccacaactgaagacccacgaaaacaaacctctcgccgacggtaatgaaccggctgcccacaaacataaacaacccgacaatttt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
29013973 |
aacataaaacaaaaacccacaactgaagacccacgaaaacaaacctctcgccgacggtaatgaaccggctggccacaaacataaacaactcgacaatttt |
29014072 |
T |
 |
| Q |
103 |
gaaaaacaaacacccaaagaccatcgaatcgatgacgggaacaacatcagtgagaccgaac |
163 |
Q |
| |
|
| ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29014073 |
g--aaacaaacacccaaagaccattgaaccgatgacgggaacaacatcagtgagaccgaac |
29014131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University