View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7168_low_8 (Length: 207)
Name: NF7168_low_8
Description: NF7168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7168_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 24413161 - 24413357
Alignment:
| Q |
1 |
ttgcacctgcaatctgcatctcagtcttgcaatgctccagaatcagctttcctttagtaaattgttcccttaggaagtgaaaccttgcttctatgttttt |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
24413161 |
ttgcatctgcaatctgcatctcagtcttgcaatgctccagaatcagctttcctttggtaacttgatccctgaggaagtgaaaccttgcttctatgtgttt |
24413260 |
T |
 |
| Q |
101 |
acttcttccatgttatacaaggtgctttgccaaatttattgcagatttgtaatcaaccttcagtgttcatgcttcttcctttccttcttctttgatg |
197 |
Q |
| |
|
|||| |||||||| | |||||||||||| | || ||||||| ||||| || ||||||||| ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
24413261 |
acttattccatgtgacacaaggtgctttcctaactttattgtagattggttatcaacctttagtgtcactgcttcttcctttccttcttcattgatg |
24413357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University