View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7168_low_9 (Length: 203)
Name: NF7168_low_9
Description: NF7168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7168_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 5e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 17 - 163
Target Start/End: Complemental strand, 43232775 - 43232630
Alignment:
| Q |
17 |
ggtgttagagttcatatattttaaatgtgcatagaagtaggttgtctgagaattaaaccccgactcctatatatattgtgcaattgtattcttattaact |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43232775 |
ggtgttagagttcacatattttaaatgtgcatagaagtgggttgtctgagatttaaaccccgactcctatatatattgtgcaa-tgtattcttattaact |
43232677 |
T |
 |
| Q |
117 |
agattaagtccacgatgacataaaaatagtattctaaataaaattaa |
163 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43232676 |
agattaagcccacgatgacataaaaatagtattttaaataaaattaa |
43232630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 156 - 193
Target Start/End: Complemental strand, 43232614 - 43232577
Alignment:
| Q |
156 |
aaaattaatttgtttcatgatttataatttgtgatgtc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43232614 |
aaaattaatttgtttcatgatttataatttgtgatgtc |
43232577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University