View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7169_high_29 (Length: 257)
Name: NF7169_high_29
Description: NF7169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7169_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 388481 - 388285
Alignment:
| Q |
1 |
ctcacagtctttgcagctgcttttccagctgctgcagcctctgcttgagccaacttggacatgttcttgtgaagctcagcgttcagtgttgccaatgcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
388481 |
ctcacagtctttgcagctgcttttccagctgctgcagcctctgcttgagccaacttggacatgttcttgtgaagctcagcgttcattgttgccaatgcta |
388382 |
T |
 |
| Q |
101 |
cctcagtttcactccctctttccttcaacatcttcagctcggttttcgttttctcaagctctgcctccagcttctttactgtatcaaaaatgttgtt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
388381 |
cctcagtttcactccctctttccttcaacatcttcagctcggttttcgttttctcaagctctgcctccagcttctttattgtatcaaaaatgttgtt |
388285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University