View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7169_low_16 (Length: 414)
Name: NF7169_low_16
Description: NF7169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7169_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 44466934 - 44466750
Alignment:
| Q |
1 |
atatttgatatccgtacatttctgcgtgcagttcggaagaatcactgaaagatacaagaaaatgcacagagcatgtttctgagaatgaactgaagagtgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44466934 |
atatttgatatccgtacatttctgcgtgcagttcggaagaatcactgaaagatacaagaaaatgcacagagcatgtttctgagaatgaactgaagagtgc |
44466835 |
T |
 |
| Q |
101 |
tgctgcttgtttcagccttaccagtgtcaactgatcagtactatgctgccctcttcccctcaacaaaaagaaaatatgaactagg |
185 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44466834 |
tgctgcttgtttcagccttactagtgtcaactgatcagtactatgctgccctcttcccctcaacaaaaagaaaatatgaactagg |
44466750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 231 - 395
Target Start/End: Complemental strand, 44466704 - 44466540
Alignment:
| Q |
231 |
ggtaatattgtcattattgagtttccaatccttcacttgtcgacattttaaatagaagcatgtttcttgtatactgaatattgtttatgagaaggcgaag |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44466704 |
ggtaatattgtcattattgagtttccaatccttcacttgtcgacattttaaatagaagcatgtttcttgtatactgaatattgtttatgagaaggcgaag |
44466605 |
T |
 |
| Q |
331 |
aataatatccagatgggacacttttcatccatttatactgaatatttgattgttcttatctacta |
395 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44466604 |
aataatatccagatgggacacttttcatccatttatactgaatatttgattgttcttatctacta |
44466540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University