View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7169_low_38 (Length: 239)
Name: NF7169_low_38
Description: NF7169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7169_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 9 - 237
Target Start/End: Original strand, 33203722 - 33203950
Alignment:
| Q |
9 |
ctttcttccatggtggagattgttcaaaccataagaaccttcaaggccttttctggaatttcacctattccaatgttttctattttcacaaccaaccaag |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33203722 |
ctttcatccatggtggagattgttcaaaccataagaaccttcaaggccttttctggaatttcacctattccaatgttttctattttcacaacgaaccaag |
33203821 |
T |
 |
| Q |
109 |
cgttactcgaagcgttgcatggatcgttatacatgcacgttgttgattttgaaattggtcttggaattcaatacgcttctcttatgaaagagattgctga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33203822 |
cgttactcgaagcgttgcatggatcgttatacatgcacgttgttgattttgaaattggtcttggaattcaatacgcttctcttatgaaagagattgctga |
33203921 |
T |
 |
| Q |
209 |
aaaagctgttaatggttcgccgttgcttc |
237 |
Q |
| |
|
|||||||||||| |||||||||||||||| |
|
|
| T |
33203922 |
aaaagctgttaacggttcgccgttgcttc |
33203950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University