View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7169_low_42 (Length: 216)

Name: NF7169_low_42
Description: NF7169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7169_low_42
NF7169_low_42
[»] chr5 (1 HSPs)
chr5 (17-159)||(43366874-43367016)


Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 17 - 159
Target Start/End: Original strand, 43366874 - 43367016
Alignment:
17 aagaaggagaaggcagacggagatggcggaaatgaggaggcggtgaatgagacgacggcggaggaaactggcaagaaggagtccgatgagtcttctggac 116  Q
    ||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
43366874 aagaaagagaaggcagacggagatggaggaaatgaggaggcgatgaatgagacgacggcggaggaaactggaaagaaggagtccgatgagtcttctggac 43366973  T
117 ttgtctgtcttctttctcttcactgatgatggtgtatgcatca 159  Q
    ||||||||||||||||||||||||||||||||| |||||||||    
43366974 ttgtctgtcttctttctcttcactgatgatggtttatgcatca 43367016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University