View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7170_high_7 (Length: 206)
Name: NF7170_high_7
Description: NF7170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7170_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 14 - 129
Target Start/End: Complemental strand, 4791849 - 4791734
Alignment:
| Q |
14 |
tggacatcaatgatgaagacaaggataggaataagaaataattccccgttgatgttggaagatggattgatccaatggatgatgtgagggatcgacactc |
113 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
4791849 |
tggacttcaatgatgaagacgaggataggaataagaaataattccccgttgatgttggaagatggattgatccaatggatgatgtgagggaccgacaccc |
4791750 |
T |
 |
| Q |
114 |
tggaaaggaaccagag |
129 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4791749 |
tggaaaggaaccagag |
4791734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 31 - 131
Target Start/End: Complemental strand, 4797368 - 4797265
Alignment:
| Q |
31 |
gacaaggataggaataagaaataattccccgttgatgttggaagatggattgatccaatggatgatgtgagggat---cgacactctggaaaggaaccag |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
4797368 |
gacaaggataggaataagaaataattccccgttgatgttggaagatggattgatccaatggatgatgtgagggatcgacgacactctagaaaggaaccag |
4797269 |
T |
 |
| Q |
128 |
agac |
131 |
Q |
| |
|
|||| |
|
|
| T |
4797268 |
agac |
4797265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 142 - 188
Target Start/End: Original strand, 4788796 - 4788842
Alignment:
| Q |
142 |
tgctgtcatattcattgtgacaaatgattccatccaatccatgaaag |
188 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4788796 |
tgctgtcatattcattgtcacaaatgattccatccaatccatgaaag |
4788842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 142 - 188
Target Start/End: Complemental strand, 4791529 - 4791483
Alignment:
| Q |
142 |
tgctgtcatattcattgtgacaaatgattccatccaatccatgaaag |
188 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4791529 |
tgctgtcatattcattgtcacaaatgattccatccaatccatgaaag |
4791483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 142 - 188
Target Start/End: Complemental strand, 4797054 - 4797008
Alignment:
| Q |
142 |
tgctgtcatattcattgtgacaaatgattccatccaatccatgaaag |
188 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4797054 |
tgctgtcatattcattgtcacaaatgattccatccaatccatgaaag |
4797008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 68 - 110
Target Start/End: Original strand, 4788530 - 4788572
Alignment:
| Q |
68 |
ttggaagatggattgatccaatggatgatgtgagggatcgaca |
110 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||| |||| |
|
|
| T |
4788530 |
ttggaagatgggttgatccaatggatgatgcgagggatggaca |
4788572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University