View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7171_high_12 (Length: 230)
Name: NF7171_high_12
Description: NF7171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7171_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 108 - 211
Target Start/End: Complemental strand, 3877158 - 3877055
Alignment:
| Q |
108 |
tcctccacaaaaccattattcattacataatagcaaactagcttattgttagccatgttttctgtgtctaattcttcttcattctcttccacttcagata |
207 |
Q |
| |
|
|||||||| |||||||||||||||| |||||| ||||| ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3877158 |
tcctccacccaaccattattcattacgtaatagaaaactgacttatggttagccatgttttctgtgtcgaattcttcttcattctcttccacttcagata |
3877059 |
T |
|
| Q |
208 |
ttac |
211 |
Q |
| |
|
|||| |
|
|
| T |
3877058 |
ttac |
3877055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 64 - 211
Target Start/End: Complemental strand, 25558545 - 25558398
Alignment:
| Q |
64 |
ggctttgcatggtgccatttagtttctcaaacatggcttgttgatcctccacaaaaccattattcattacataatagcaaactagcttattgttagccat |
163 |
Q |
| |
|
|||||| |||| |||||||| ||||||| | | ||||||||| ||||| || ||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
25558545 |
ggcttttcatgttgccattttgtttctcgatctaggcttgttgctcctcagcacaaccattattcattacataatagacaactagcttatggttagccat |
25558446 |
T |
|
| Q |
164 |
gttttctgtgtctaattcttcttcattctcttccacttcagatattac |
211 |
Q |
| |
|
| |||||| ||| || | ||||| | | ||||| |||||||||||||| |
|
|
| T |
25558445 |
ggtttctgcgtcaaaatgttctttagtatcttctacttcagatattac |
25558398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University