View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7171_high_5 (Length: 320)
Name: NF7171_high_5
Description: NF7171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7171_high_5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 65 - 320
Target Start/End: Complemental strand, 38470180 - 38469921
Alignment:
| Q |
65 |
atgtataccggtacaatgaatccttaaattaacagctaaccaaaatttgtttttgaaaagtaatatcgttttctatgtttaagcaccttg----ccagga |
160 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38470180 |
atgtataccggtataatgaatccttaaattaatagctaaccaaaatttgtttttgaaaaataatatcgttttctatgtttaagcaccttgttaaccagga |
38470081 |
T |
 |
| Q |
161 |
tgaaggtttagggacgttgttgcttgaacaatttatccatgttttaagcaccttccttgtcctcattgtatagacaaattcttgaactaggattttaagg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38470080 |
tgaaggtttagggacgttgttgcttgaacaatttatccatgttttaagcaccttccttgtcctcattgtgtagacaaattcttgaactaggattttaagg |
38469981 |
T |
 |
| Q |
261 |
ataaaatgtaattttgtttccaccctgctaatttactattaagttgatcaattatatatt |
320 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38469980 |
ataaaatgtaattttgtttccaccctactaatttactattaagttgatcaattatatatt |
38469921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University