View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7171_low_10 (Length: 248)
Name: NF7171_low_10
Description: NF7171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7171_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 29 - 223
Target Start/End: Original strand, 31695840 - 31696034
Alignment:
| Q |
29 |
atattccatacttaatttagtgtaataatctttattttgatattaaagttttgtagcatatacaaagatcaatccgaatattgaaccaagttgagtcaag |
128 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31695840 |
atattccatacttaatttagggtaataatctttattttgatattaaagttttgtagcatatgcaaagatcaatccgaatattgaaccaagttgagtcaag |
31695939 |
T |
|
| Q |
129 |
ttgttgacaatcaaagtgccgggtcagacaccatgacatcgaagtcattgactatagttgcaaaaaatactacagactattcggtaatattaaac |
223 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31695940 |
ttgttgacaatcaaagtgccgggtaagacactatgacatcgaagtcattgactatagttgcaaaaaatactacagactattcggtaatattaaac |
31696034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University