View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7171_low_12 (Length: 230)

Name: NF7171_low_12
Description: NF7171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7171_low_12
NF7171_low_12
[»] chr7 (1 HSPs)
chr7 (108-211)||(3877055-3877158)
[»] chr5 (1 HSPs)
chr5 (64-211)||(25558398-25558545)


Alignment Details
Target: chr7 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 108 - 211
Target Start/End: Complemental strand, 3877158 - 3877055
Alignment:
108 tcctccacaaaaccattattcattacataatagcaaactagcttattgttagccatgttttctgtgtctaattcttcttcattctcttccacttcagata 207  Q
    ||||||||  |||||||||||||||| |||||| |||||  ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||    
3877158 tcctccacccaaccattattcattacgtaatagaaaactgacttatggttagccatgttttctgtgtcgaattcttcttcattctcttccacttcagata 3877059  T
208 ttac 211  Q
    ||||    
3877058 ttac 3877055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 64 - 211
Target Start/End: Complemental strand, 25558545 - 25558398
Alignment:
64 ggctttgcatggtgccatttagtttctcaaacatggcttgttgatcctccacaaaaccattattcattacataatagcaaactagcttattgttagccat 163  Q
    |||||| |||| |||||||| ||||||| | |  ||||||||| |||||  || |||||||||||||||||||||||  ||||||||||| |||||||||    
25558545 ggcttttcatgttgccattttgtttctcgatctaggcttgttgctcctcagcacaaccattattcattacataatagacaactagcttatggttagccat 25558446  T
164 gttttctgtgtctaattcttcttcattctcttccacttcagatattac 211  Q
    | |||||| ||| || | ||||| | | ||||| ||||||||||||||    
25558445 ggtttctgcgtcaaaatgttctttagtatcttctacttcagatattac 25558398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University