View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7172_low_3 (Length: 378)
Name: NF7172_low_3
Description: NF7172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7172_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 1 - 363
Target Start/End: Complemental strand, 39676836 - 39676465
Alignment:
| Q |
1 |
ttgtttgtttgcgcatctttctagtttgtgtaccacaagtatttgtctgtgcatattctgtttagattgaagtttttccgcatgatcctttccgtttaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39676836 |
ttgtttgtttgcgcatctttctagtttgtgtaccgcaagtttttgtctgtgcatattctgtttagattgaagttttgccgcatgatcctttccgtttaga |
39676737 |
T |
|
| Q |
101 |
gtttcagcctccaaagtgagtgctggctctatattatttaaatttgttttaaagttgcgacactacttccggataagcttttagtttacggcattggcct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39676736 |
gtttcagcctccaaagtgagtgctggctctatattgtttaaatttgttttaaagttgcgac---acttccggataagcttttagtttacggcattggcct |
39676640 |
T |
|
| Q |
201 |
aactaa------------atttgaagttgcacatttgagtttgagtttcaattgccggagtgagcacgtccagtatcgctgcggtttggtatgacatggt |
288 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39676639 |
aactaacaccttttttttatttgaagttgcacctttgagtttgagtttcaattgccggagtgagcacgtccagtatcgctgcggtttggtatgacatggt |
39676540 |
T |
|
| Q |
289 |
gacacatttctattaacgcttcagctaccagattagcatttatttaacatcattgcagtttttggtgtttttctt |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39676539 |
gacacatttctattaacgcttcagctaccagatgagcacttatttaacatcattgcagtttttggtgtttttctt |
39676465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University