View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7173_high_12 (Length: 221)
Name: NF7173_high_12
Description: NF7173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7173_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 46170132 - 46169946
Alignment:
| Q |
17 |
aaaatctctcaaaaagcaaaacaaatcaacggttccatcatgaacaaattatattaacccataccctagcatacctataatatttttattatacttttta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46170132 |
aaaatctctcaaaaagcaaaacaaatcaacggttccatcatgaacaaattatattaacccataccctagcatacctataatatttttattatacttttta |
46170033 |
T |
|
| Q |
117 |
gaattaataataataattcatgttaatcacaatgcaggtatctgaacactggtgatccaaaagggacagattggctaccagcagaat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46170032 |
gaattaataataataattcatgttaatcacaatgcaggtatctgaacactggtgatccaaaagggacagattggctaccagcagaat |
46169946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University