View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7173_low_15 (Length: 241)
Name: NF7173_low_15
Description: NF7173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7173_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 3 - 232
Target Start/End: Complemental strand, 1051481 - 1051252
Alignment:
| Q |
3 |
tatggtccacaataaataatttgatgggtttaaatcaaggtgtaaatcgtaatgacagcgttcaacatctctttatgtgagaaatttggtcttgaataag |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1051481 |
tatggtccacaataaataatttgatgggtttaaatcaaggtgtaaattgtaatgacggcgttcaacatctctttatgtgagaaatttggtcttgaataag |
1051382 |
T |
|
| Q |
103 |
cgcttgaagataaatcattatcttattttggtggctattattttgtgtttttagccgctcggaacaatgttattttttaagaaggggttctggattgcaa |
202 |
Q |
| |
|
||||||||||| ||||||| |||||||| || ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1051381 |
cgcttgaagattaatcatttccttattttagtagctattattttatgtttttagccgctcgaaacaatgttattttttaagaaggggttgtggattgcaa |
1051282 |
T |
|
| Q |
203 |
ttcgataatctctcaaattaagatgatgtc |
232 |
Q |
| |
|
||||||||||||||||||||| ||| |||| |
|
|
| T |
1051281 |
ttcgataatctctcaaattaaaatggtgtc |
1051252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University