View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7174_high_14 (Length: 246)
Name: NF7174_high_14
Description: NF7174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7174_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 53 - 233
Target Start/End: Original strand, 36285684 - 36285864
Alignment:
| Q |
53 |
ttatgaatagcattcaaacggcatgcaatggtccttatctcaaattgttggtattttgtgtaatatatgggacttcagcatttaaacttgattctctatc |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36285684 |
ttatgaatagcattcaaacggcatgcaatggtccttatctcaaattgttggtattttgtgtaatatatgggacttcagcatgtaaacttgattctctatc |
36285783 |
T |
 |
| Q |
153 |
tgtgggaagtcttctactaatataacatggctaagaaaagtttaaattcctttcttatgcatttgatcgaaacttgatgtc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36285784 |
tgtgggaagtcttctactaatataacatggctaagcaaagtttaaattcctttcttatgcatttgatcgaaacttgatgtc |
36285864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University